DNA'NIN GİZLİ DÜNYASI

Teknolojik bir ürünün veya tesisin yapımında ve yönetiminde insanoğlunun yüzyıllar boyunca elde ettiği tecrübe ve bilgi birikimi kullanılır. Dünyanın en ileri ve karmaşık tesisi olan insan vücudunun inşası için gereken bilgi ve tecrübe ise DNA'da saklıdır. Burada vurgulanması gereken önemli nokta, DNA'nın daha ilk insandan itibaren şimdiki mükemmellik ve karmaşıklığıyla birlikte var olageldiğidir. Akıllara durgunluk veren yapı ve özellikleriyle, böyle bir molekülün, evrimcilerin öne sürdüğü gibi tesadüf ve rastlantılar sonucu oluşmasının ne derece mantık dışı olduğunu ilerleyen satırları okudukça sizler de daha net göreceksiniz.

 

DNA, hücrenin ortasında yer alan çekirdekte titizlikle korunmaktadır. İnsanda (sayıları 100 trilyona varan) hücrelerin ortalama çapının 10 mikron (mikron=milimetrenin binde biri) olduğu hatırlanacak olursa, ne kadar küçük bir alandan söz edildiği daha iyi anlaşılır. Bu mucizevi molekül, Allah'ın yaratma sanatındaki mükemmellik ve olağanüstülüğün açık bir kanıtıdır. Öyle ki yalnızca bu molekülü incelemek ve halen pek azı günışığına çıkmış sırlarını araştırmak için özel bir bilim dalı bile kurulmuştur: "Genetik"... 21. yüzyılın bilimi olarak kabul edilen Genetik, elindeki her türlü teknolojik olanaklara rağmen DNA'nın esrarını çözme konusunda henüz emekleme safhasındadır. 

ÇEKİRDEKTEKİ HAYAT

İnsan vücudu bir yapıya benzetilecek olursa; bu yapının en ince ayrıntısına kadar eksiksiz bir plan ve projesi, bütün teknik ayrıntılarıyla her hücrenin çekirdeğindeki  DNA'da mevcuttur.  İnsanın anne karnındaki ve doğumundan sonraki gelişmelerin hepsi önceden belirlenmiş bir program çerçevesinde düzenlenir. İnsanın gelişimindeki bu kusursuz düzenleme Kur'an'da şöyle ifade ediliyor: 

İnsan, 'kendi başına ve sorumsuz' bırakılacağını mı sanıyor? Kendisi, akıtılan meniden bir damla su değil miydi? Sonra bir alak (embriyo) oldu, derken (Allah, onu) yarattı ve bir 'düzen içinde biçim verdi.' (Kıyamet Suresi, 36-38)

Daha anne karnında yeni döllenmiş bir yumurta hücresi halinde iken, ilerde sahip olacağımız bütün özellikler bir kader tarafından belirlenmiş ve "bir düzen içinde" DNA'larımıza yerleştirilmiştir. Otuz yaşına geldiğimizde sahip olacağımız boy, renk, kan grubu, yüz şekli gibi bütün özelliklerimiz otuz yıl dokuz ay öncesinden, yani döllendiğimiz andan itibaren başlangıç hücremizin çekirdeğinde kodlanmıştır. 

DNA'daki bu bilgiler sadece az önce değindiğimiz fiziksel özellikleri belirlemez. Aynı zamanda hücre ve vücuttaki binlerce farklı olayı ve sistemi de kontrol eder. Örneğin, insanın kan basıncının alçak, yüksek veya normal olması bile DNA'daki bilgilere bağlıdır.

İNSAN HÜCRESİNDEKİ DEV ANSİKLOPEDİ

DNA'da kayıtlı bulunan bu bilgi pek hafife alınacak gibi değildir. Öyle ki, inanması güç fakat insanın tek bir DNA molekülünde tam bir milyon ansiklopedi sayfasını dolduracak miktarda bilgi bulunur. Dikkat edin; tam 1.000.000 ansiklopedi sayfası... Yani, her bir hücrenin çekirdeğinde, insan vücudunun işlevlerini kontrol etmeye yarayan bir milyon sayfalık bir ansiklopedinin içerebileceği miktarda bilgi kodlanmıştır. Bir karşılaştırma yapmak istersek, dünyanın en büyük ansiklopedilerinden birisi olan 23 ciltlik "Encyclopedia Britannica"nın bile toplam 25 bin sayfası vardır. Bu durumda, karşımıza inanılmaz bir tablo çıkar. Mikroskobik hücrenin kendisinden çok daha küçük olan çekirdeğindeki bir molekülde, milyonlarca bilgi içeren dünyanın en büyük ansiklopedisinin 40 katı büyüklüğünde bir bilgi deposu saklı durmaktadır. Bu da 920 ciltlik, dünyada başka eşi, benzeri olmayan dev bir ansiklopedi demektir. Yapılan tesbitlere göre ise, bu dev ansiklopedi yaklaşık 5 milyar farklı bilgiye sahiptir.

Bu son iki kelimeyi tekrarlayalım; "bilgiye sahiptir"...

İşte burada durup, ağzımızdan kolayca çıkıveren bu iki kelime üzerinde düşünmemiz gerekir. Bir hücrenin içinde milyarlarca bilgi olduğunu söylemek kolaydır. Ancak bu, hiç de öyle laf arasında söylenip geçilebilecek bir ayrıntı değildir. Çünkü, burada sözünü ettiğimiz bir bilgisayar veya kütüphane değil, yalnızca protein, yağ ve su moleküllerinden oluşan, milimetreden 100 kat daha küçük bir küptür. Bu küçücük et parçasının içinde, değil milyonlarca bilgi, tek bir bilginin var olması ve onun bu bilgiyi muhafaza etmesi bile son derece hayret verici bir mucizedir.

DNA'nın yeri: Yanda, hücrenin ortasında bulunan hücre çekirdeğinin şeması yer alıyor. DNA işte bu hücre çekirdeğinin içinde saklıdır. Ve bir insan hakkındaki bütün bilgileri içerir.

İnsanlar modern çağda bilgiyi saklamak için bilgisayarları kullanıyorlar. Bilgisayar teknolojisi ise bugün bütün diğer teknolojilerin başını çeken en ileri teknoloji olarak kabul ediliyor. Bundan 20 yıl önce, oda büyüklüğündeki bir bilgisayarın sahip olabildiği bilgiyi, bugün küçük "mikroçip"ler saklayabilmekte... İnsan zekasının asırlardır edindiği bilgi birikimi ve yıllar süren çabaları sonucunda geliştirdiği bu son teknoloji bile daha tek bir hücre çekirdeğinin bilgi saklama kapasitesine uzaktan yakından ulaşabilmiş değil. Böyle muazzam bir kapasiteye sahip olan DNA'nın küçüklüğünü yansıtması açısından şu karşılaştırma yeterlidir sanırız:

Bugüne kadar yaşamış, gelmiş geçmiş her canlı türünün bütün özellikleri bilgi olarak DNA'ya yüklense toplam DNA hacmi bir çay kaşığının ancak küçük bir kısmını doldururdu. Dahası geriye şu ana kadar yazılmış bütün kitapları saklayabilecek kadar boşluk kalırdı. (Denton Michael, "A Theory in Crisis", s. 334)

Gözle göremediğimiz, çapı milimetrenin milyarda biri büyüklüğünde olan, basit atomların yanyana dizilmesiyle oluşmuş bir zincir, acaba böyle bir bilgiye ve hafızaya nasıl sahip olabilir? Bu soruya şunu da ekleyelim: Vücudunuzdaki 100 trilyon hücreden herbiri bir milyon sayfayı ezbere biliyorken, acaba siz zeki ve şuurlu bir insan olarak hayatınız boyunca kaç ansiklopedi sayfası ezberleyebilirsiniz?

HÜCRENİN AKLI

Bu durumda şunu kabul etmelisiniz ki midenizdeki ya da kulağınızdaki herhangi bir hücre sizden kat kat daha bilgili, bu bilgiyi en doğru ve en kusursuz şekilde değerlendirdiği için de sizden çok daha akıllıdır. Peki bu aklın kaynağı nedir? Nasıl olur da vücudunuzdaki 100 trilyon hücrenin herbiri ayrı ayrı böylesine inanılmaz bir akla sahip olabilir? Bunlar sonuçta birer atom yığınıdır ve bilinç sahibi değildirler. Tüm elementlerin atomlarını alın, farklı biçimlerde ve sayılarda birbirlerine bağlayın, farklı moleküller oluşturun, yine de akıl elde edemezsiniz. Bu moleküllerin büyük, küçük, basit ya da karmaşık olması da birşey değiştirmez. Sonuçta, bilinçli olarak bir işi organize edip başaracak bir zihin asla ortaya çıkaramazsınız.

O zaman nasıl oluyor da, yine aynı şekilde, belli sayıdaki cansız atomun belli şekillerde dizilmesinden meydana gelmiş DNA ve onunla uyumlu olarak çalışan enzimler bilinçli birçok işler yapıp, hücredeki sayısız karmaşık ve farklı işlemi kusursuz ve mükemmel şekilde organize ediyorlar? Bunun cevabı çok basittir; akıl, bu moleküllerde ya da bunları içinde barındıran hücrede değil, bu molekülleri, bu işleri yapacak şekilde programlanmış olarak var edenin kendisindedir.

Kısaca akıl eserde değil, o eseri yaratanda bulunur. En gelişmiş bilgisayar bile, onu en ince ayrıntısına dek tasarlayan, onu çalıştıracak programları yazıp ona yükleyen ve kullanan bir akıl ve zekanın ürünüdür. Aynı şekilde, hücre de, içindeki DNA ve RNA'lar da, bu hücrelerden meydana gelen insan da, kendilerini ve yaptıkları işleri Yaratanın eserinden başka birşey değildirler. Eser ne kadar mükemmel, kusursuz ve etkileyici olursa olsun, akıl her zaman o eserin sahibindedir.

Bir gün bir bilgisayar laboratuvarında, masanın üstünde çok gelişmiş bir disket bulsanız, ve onu bir bilgisayar yardımıyla okuyup içinde, sizin şahsınıza özel milyarlarca bilgi olduğunu görseniz, aklınıza gelecek ilk soru, bu bilgilerin kim tarafından ve ne amaçla yazıldığı olurdu.

Peki aynı soruyu neden hücre için sormuyoruz? Disket içindeki bilgiler birileri tarafından oraya yazılmış ise, bundan çok daha üstün ve ileri bir teknolojiye sahip olan DNA, kim ve hangi akıl tarafından en mükemmel şekilde tasarlanıp, yaratılıp, kendisi de ayrı bir mucize olan minicik hücrenin içine özenle yerleştirilmiştir? Hem de binlerce yıl öncesinden günümüze kadar hiçbir özelliğini kaybetmeden. (Disketi yapan ve içine bilgileri yazan insanın beyninin de bu hücrelerden oluştuğunu unutmayalım.) Bu satırları okumanız, görmeniz, nefes almanız, düşünmeniz, kısaca var olmanız ve varlığınızı sürdürmeniz için her an görev başında olan bu hücrelerin kim tarafından ve niçin yapıldığını sormaktan daha önemli ne olabilir? Hayatta en çok merak etmemiz gereken, bu sorunun cevabı değil midir sizce? 
 


Hücre çekirdeğinde bulunan DNA'nın moleküler yapısının bir kesitinin bilgisayar modellemesi

TESADÜFLER DÜZEN OLUŞTURABİLİR Mİ?

Ünlü bir yöntemdir: Bir uçak kazası sonucunda ıssız bir araziye düşüp mahsur kalan yolcular, kendilerini havadan arayan kurtarma ekiplerine yerlerini belli etmek için büyük bir "X" çizerler. Ellerindeki eşyaları ya da topladıkları cisimleri kullanarak düzgün ve büyük bir çarpı oluştururlar. Böylece havadan keşfe çıkan ekip, bu "akıl ürünü" işareti görür ve orada akıl sahibi varlıkların, yani insanların bulunduğunu anlar.

Türkiye'deki şehirlerarası karayollarında ilerlerken, bazen yolun kenarındaki tepelerin yamaçlarında beyaz taşlardan yazılmış yazılar görürsünüz; "Herşey Vatan İçin", ya da "Ne Mutlu Türküm Diyene" gibi. Bu yazıların orada nasıl oluştuğu ise son derece açıktır. Oralarda bir yerde bir askeri birlik vardır ve mıntıka temizliği yaparken tepenin üzerine beyaz taşlardan oluşan bu tür yazılar yazmışlardır.

Peki acaba hiç kimse çıkıp da bu yazıların bilinçli bir zihin, örneğin askerler tarafından yazılmadığını, aksine tesadüfen oluştuklarını söyleyebilir mi? Hiç kimse, çıkıp da "bu taşlar tepeden aşağı yuvarlanırken tesadüfen yanyana gelmiş ve 'Herşey Vatan İçin' cümlesini oluşturmuşlar" diyebilir mi?



DNA sarmalının iki farklı illustrastyonu

Ya da bir "bilim adamı" çıksa ve, "dünyada trilyonlarca taş var bunlar milyonlarca yıldır yuvarlanıyorlar, bu durumda taşların bir kısmının tesadüfen böyle anlamlı bir yazı oluşturacak şekilde yuvarlanıp biraraya gelmesi mümkündür" dese buna çocuklar bile gülmez mi? Üstüne bir de bilimsel üslup kullansa, bilimsel açıklamalar yapsa, olasılık hesapları gösterse, herkes onun aklından daha da çok şüphe etmez mi? Çünkü bırakın "Herşey Vatan İçin" cümlesinin, düzgün bir "H" harfinin bile kendi kendine tesadüfen oluşması gibi bir ihtimal yoktur. Dağın tepesinde beyaz taşlardan oluşmuş düzgün bir "H" görseniz, "bunu buraya yazmakla ne demek istemişler" diye düşünürsünüz.

Bu örneklerle anlatmak istediğimiz şudur: Eğer bir yerde en ufak bir planlanmışlık varsa, orada mutlaka bir akıl sahibinin izleri vardır. Hiçbir akıl ürünü tesadüfen oluşmaz. Bir dağın üzerine milyarlarca kez beyaz taşlar yuvarlasanız, "Herşey Vatan İçin" yazısı, hatta düzgün bir "H" bile elde edemezsiniz. Eğer bir yerde bir harf varsa, herkes kabul eder ki, mutlaka o harf biri tarafından yazılmıştır. Yazarsız harf olmaz.

İnsanın bedeni ise, "Herşey Vatan İçin" cümlesinden trilyonlarca kez daha kompleks bir yapıya sahiptir ve bu karmaşık yapının kendiliğinden, ya da "tesadüfen" oluşmuş olması kesinlikle ve kesinlikle mümkün değildir. Öyleyse insanı da, onun hücresini de, DNA'sını da kusursuz ve mükemmel bir şekilde planlayıp düzenleyen bir Yaratıcı vardır. Bunun aksini iddia etmek, olabilecek en büyük akılsızlık, akılsızlıkla birlikte samimiyetsizlik ve küstahlıktır. O aklın ve gücün sahibine karşı büyük bir saygısızlıktır. 

Oysa, ne yazık ki, taşların kendi kendilerine dizilip üç küçük kelimeyi bile yazabilmelerinin imkansız olduğunu bir çırpıda söyleyecek birçok kişi, milyarlarca atomun tek tek planlanmış bir dizilimle biraraya gelip DNA gibi muhteşem işler başarabilen bir molekül oluşturmasının "tesadüfler" sonucu olduğu aldatmacasını itiraz etmeden dinleyebilmektedir. Tıpkı hipnotize edilen bir kişinin yapılan telkinle, kendisinin bir kapı, ağaç ya da kertenkele olduğuna itiraz etmemesi, kabul etmesi gibi...

DNA ANSİKLOPEDİSİNİN DİLİ

Toplumların hayatı bilgi akışı ve haberleşme üzerine kuruludur. Fertler ve nesiller arasındaki bilgi akışında en önemli araç ise dildir. Dil belirli şifreler yani harfler ile temsil edilir. Türkçe 29 harften, ya da bir diğer deyişle 29 şifreden oluşan bir dildir. Bu şifreler kelimeleri, kelimeler de cümleleri oluşturur. Bilgi akışı ve depolanması bu şifreler sayesinde gerçekleşir.

Hücredeki lisan da işte buna benzer. İnsanın bütün fiziksel özellikleri bu dil vasıtasıyla kodlanarak hücre çekirdeğine depolanmıştır ve yine bu dil sayesinde hücre tarafından kullanılabilir. Bu dil, DNA adlı yönetici molekülün dilidir. Dört harfli bu DNA dili A, T, G ve C harflerinden oluşur. Her harf, "nükleotid" adı verilen dört özel bazdan birini temsil eder. Bu bazların milyonlarcası, anlamlı bir sıralama ile üstüste dizilerek DNA molekülünü oluştururlar.



DNA'NIN DÖRT HARFLİ ALFABESİ

Adenin, timin, sitozin ve guanin bazlarının DNA içerisindeki dizilimi. Bazlar karşılıklı olarak hidrojen bağlarıyla bağlanırlar. Birbirlerine bağlanan bu bazların sıralamaları hayatın dilini oluşturur.

İşte çekirdekteki bilgi bankasında bilgiler bu şekilde depolanmıştır. Biz bu bilgi deposundaki şifreleme sistemini anlatırken, kolaylık için, DNA'yı oluşturan nükleik asit molekülleri için yine harf benzetmesini kullanmaya devam edeceğiz. Bu harfler ikişerli olarak karşılıklı eşleşir ve birer basamak oluştururlar. Bu basamaklar ise üstüste eklenerek genleri meydana getirirler. DNA molekülünün bir bölümü olan herbir gen insan vücudundaki belli bir özelliği kontrol eder. Boyun uzunluğu, gözün rengi, burnun, kulağın, kafatasının şekli gibi sayısız özellik ilgili genlerin emriyle meydana gelir. Bu genlerin herbirini bir kitabın sayfalarına benzetebiliriz. Sayfaların üzerinde ise A -  T - G - C harflerinden oluşmuş yazılar vardır.  

İnsan hücresindeki DNA'larda 200.000 civarında gen bulunur. Her gen, karşılığı olduğu protein türüne göre, sayıları 1000 ile 186.000 arasında değişen nükleotidlerin özel bir sıralamada dizilmesinden oluşur. Bu genler insan vücudunda görev yapan yaklaşık 200.000 civarındaki proteinin kodlarını saklar ve bu proteinlerin üretimini denetler.


DNA'NIN DEPOLANIŞI
Her kromozomda tek bir DNA bulunur. Tek hücrede bulunan DNA molekülünün toplam uzunluğu 1 metreyi bulur. Kromozomun toplam kalınlığı ise 1 nanometre, yani metrenin milyarda biri kadardır. Bir metre uzunluğundaki DNA molekülünün kendi uzunluğunun milyarda biri kalınlığında bir bölgeye paketlenmesi, bu DNA'nın her an okunması, zamanı geldiğinde bir kopyasının oluşturulması ve bütün bu işlemler sırasında hiçbir karmaşa çıkmaması, hücrenin içinde akılalmaz derecede kompleks bir tasarımın, yani yaratılışın var olduğunun açık delilidir.

Bu 200.000 genin içerdiği bilgi DNA'daki toplam bilginin yalnızca % 3'ünü teşkil eder. Geriye kalan % 97'lik bölüm ise günümüzde hala esrarını korumaya devam etmektedir. Son yıllardaki araştırmalar bu % 97'lik karanlık bölümde vücuttaki çok karmaşık faaliyetlerin yönetimini sağlayan mekanizmalar ve hücrenin varlığını sürdürmesiyle ilgili hayati bilgiler bulunduğunu göstermiştir. Ancak daha katedilecek çok yol vardır.

Genler kromozomların içinde bulunur. Her insan hücresinin (üreme hücreleri hariç) çekirdeğinde ise 46 kromozom vardır.  Herbir kromozomu, gen sayfalarından meydana gelmiş bir cilde benzetirsek, hücrede insanın tüm özelliklerini içeren 46 ciltlik bir "hücre ansiklopedisi" vardır diyebiliriz. Daha önceki ansiklopedi örneğini hatırlarsak, bu hücre ansiklopedisi tam 920 ciltlik "Encyclopedia Britannica"nın içerdiği bilgiye eşdeğerdir.

Her insanın DNA'sındaki harflerin dizilimi farklı farklıdır. Şu ana kadar dünya üzerinde yaşamış milyarlarca insanın tümünün birbirinden farklı olmalarının altında yatan neden de budur.

Organların ve uzuvların temel yapı ve işlevleri her insanda aynıdır. Ancak herkes o kadar ince farklılıklarla o kadar ayrıntılı ve özel yaratılır ki bütün insanlar tek bir hücrenin bölünmesiyle meydana geldikleri, ve aynı temel yapıya sahip oldukları halde, milyarlarca değişik insan ortaya çıkmıştır.

Vücudumuzda bulunan bütün organlar genlerin tarif ettiği bir plan çerçevesinde inşa edilirler. Birkaç örnek verirsek; bilimadamlarının çıkardıkları bir gen atlasına göre vücudumuzda, deri 2.559, beyin 29.930, göz 1.794, tükrük bezi 186, kalp 6.216, göğüs 4.001, akciğer 11.581, karaciğer 2.309, bağırsak 3.838, iskelet kası 1.911 ve kan hücreleri 22.092 gen tarafından kontrol edilmektedir.

DNA'daki harflerin diziliş sırası insanın yapısını en ince ayrıntılara dek belirler. Boy, göz, saç ve cilt rengi gibi özelliklerin yanısıra, vücuttaki 206 kemiğin, 600 kasın, 10.000 işitme siniri ağının, 2 milyon optik sinir ağının, 100 milyar sinir hücresinin ve 100 trilyon hücrenin planları tek bir hücrenin DNA'sında mevcuttur.

Şimdi bu bilgilerin ardından düşünelim: Bir harf bile, bir yazar olmadan oluşamadığına göre, insan hücresindeki milyarlarca harf nasıl oluşmuştur? Bu harfler nasıl olup da böyle mükemmel ve karmaşık bir bedenin eşsiz planını oluşturacak bir düzende birbiri ardına anlamlı bir şekilde dizilmiştir? Eğer bu harflerin düzeninde çok ufak bir bozulma olsaydı, kulağınız karnınızda yer alır ya da gözleriniz topuklarınızda bulunabilirdi. Elleriniz sırtınıza yapışmış olarak doğabilir, bir hilkat garibesi olarak yaşam sürebilirdiniz. Şu anda düzgün bir insan olarak yaşam sürdürmenizin sırrı, DNA'larınızda bulunan 46 ciltlik ansiklopedideki milyarlarca harfin "hatasız" olarak birbiri ardına dizilmiş olmasındadır.

DNA TESADÜFE MEYDAN OKUYOR

Matematik bugün DNA'da yazılı bilgilerin oluşumunda tesadüfe yer olmadığını kanıtlamıştır. Değil milyonlarca basamaktan oluşan DNA molekülünün, DNA'yı oluşturan 200.000 genden tek bir tanesinin bile tesadüfen oluşabilme ihtimali 'imkansız' kelimesinin anlamının dahi zayıf kaldığı bir durumdur. Evrimci bir biyolog olan Salisbury bu imkansızlıkla ilgili olarak şunları söylemiştir:

Orta büyüklükteki bir protein molekülü, yaklaşık 300 aminoasit içerir. Bunu kontrol eden DNA zincirinde ise, yaklaşık 1000 nükleotid bulunacaktır. Bir DNA zincirinde dört çeşit nükleotid bulunduğu hatırlanırsa, 1000 nükleotidlik bir dizi, 4 üzeri 1000 farklı şekilde olabilecektir. Küçük bir logaritma hesabıyla bulunan bu rakam ise, aklın kavrama sınırının çok ötesindedir. (Frank B. Salisbury, "Doubts About The Modern Synthetic Theory of Evolution", s. 336)

Yani ortamda bütün gerekli nükleotidlerin bulunduğunu, bunların aralarında bağlanması için gereken bütün kompleks moleküllerin ve bağlayıcı enzimlerin hepsinin hazır olduğunu farzetsek bile bu nükleotidlerin istenen sırada dizilmesi ihtimali 4 üzeri 1000'de 1, diğer bir ifadeyle, 10 üzeri 620'de 1 ihtimal demektir.

Kısaca insan vücudundaki ortalama bir proteinin DNA'daki şifresinin şans eseri, kendi kendine oluşma ihtimali, 10'un yanında 620 tane sıfır olan sayıda 1'dir. Bu astronomik olmanın da ötesindeki sayı ise, pratik olarak "0" ihtimal anlamına gelir. Demek ki böyle bir dizilim ancak akıllı ve şuurlu bir gücün bilgi ve kontrolü altında gerçekleşmek zorundadır.

Şu anda okumakta olduğunuz yazıyı düşünün. Harflerin kendi kendilerine ve rastgele biraraya gelerek böyle bir yazı oluşturduklarını iddia eden birisine ne gözle bakardınız? Belli ki bu yazı,akıllı ve bilinçli birisi tarafından kaleme alınmıştır. İşte DNA'daki durum da bundan hiç farklı değildir.

DNA'nın yapısını keşfeden biyokimyacı Francis Crick, konu üzerinde yaptığı çalışmalardan dolayı Nobel ödülü aldı. İlk zamanlarda koyu bir evrimci olan Crick, DNA'nın mucizevi yapısına şahit olduktan sonra yazdığı eserinde bilimsel bir gerçeği şöyle ifade etmiştir: "Bugün sahip olduğumuz bilgiler ışığında, dürüst bir adamın yapabileceği tek yorum, hayatın bir mucize eseri olarak ortaya çıktığıdır." Crick'e göre hayat kesinlikle tesadüflere bağlı olarak dünya üzerinde var olamazdı. Görüldüğü gibi DNA üzerinde en uzman kişi bile yaratılışta tesadüfe yer vermiyordu.

Beş milyar harften oluşan DNA'daki bilgiler, A - T - G - C harflerinin birbiri ardına özel ve anlamlı bir sıra içinde dizilmesi ile oluşur. Ancak bu sıralamada tek bir harf hatasının dahi yapılmaması gerekir. Ansiklopedide yanlış yazılmış bir kelime ya da harf hatası önemsenmez, geçilir. Hatta farkedilmez bile. Buna karşın, DNA'da herhangi bir basamaktaki, örneğin 1 milyar 719 milyon 348 bin 632'nci basamaktaki bir harfin yanlış kodlanması gibi bir hata bile, hücre için, dolayısıyla insan için korkunç sonuçlara yol açar. Mesela çocuklarda görülen hemofili (kan kanseri) hastalığı bu tip bir yanlış kodlanmanın sonucudur.

İşin aslı, buna "yanlış kodlama" demek doğru olmaz. Çünkü var olan her şey gibi, insanın DNA'sı da Allah tarafından yaratılmıştır ve nadiren de olsa görülebilecek hatalar belli bir hikmet (ilahi amaç) dahilinde ortaya çıkar. Kanser meydana getiren kodlama bozukluğu, özel olarak yaratılmış bir bozukluktur. İnsana, kendi güçsüzlüğünü, acizliğini göstermek, insanın aslında ne derece hassas dengeler üzerinde yaratıldığını ve bu dengelerdeki en ufak bir bozulmayla başına ne gibi sıkıntılar gelebileceğini hatırlatmak için Allah tarafından özel olarak, belli bir hikmet dahilinde yaratılmıştır. 
 


CCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAG
CCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACAC
AACTGTGTTCACTAGCAACTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGT
CTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGG
GCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTG
GAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTAT
TTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTT
GGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAG
AAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTT
GCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGT

DNA'DAKİ ŞİFRE

DNA vücutta üretilen tüm proteinlerin şifresini içerir. Yüzbinlerce proteinin tek birisini oluşturan parçlardan yalnızca birisinin genetik şifresi ise, yanda görüldüğü gibi son derece karmaşıktır. İnsan vücudunun tamamı için bu şifrelerden milyarlarcası gereklidir. Böylesine mikemmel bir bilgi, onu yaratıp düzenleyen üstün bir akıl olmadan asla var olamaz. 


DNA'NIN KENDİNİ EŞLEMESİ

Bilindiği gibi hücreler bölünerek çoğalırlar. Öyle ki, insan vücudu başlangıçta tek bir hücre iken bu hücre bölünür ve sonuçta 2-4-8-16-32... oranında bir katlanmayla çoğalır.

Peki bu bölünme işlemi sonucunda DNA'ya ne olur? Hücrede tek bir DNA zinciri vardır. Halbuki yeni doğan hücrenin de bir DNA'ya ihtiyacı olacağı açıktır. Bu açığı gidermek için DNA, her aşaması ayrı bir mucize olan ilginç bir seri işlem yapar. Sonuçta, hücrenin bölünmesinden kısa bir süre önce kendisinin bir kopyasını çıkarır ve bunu yeni hücreye aktarır!...

Hücrenin bölünmesi ile ilgili yapılan gözlemler göstermektedir ki hücre, bölünmeden önce belirli bir büyüklüğe ulaşmak zorundadır. Bu belirli büyüklük sınırını aştığı anda ise bölünme süreci kendiliğinden başlar. Hücrenin şekli bölünmeye uygun olarak yayvanlaşırken, DNA da az önce belirttiğimiz gibi kendini eşlemeye başlar.

Bunun anlamı şudur: Hücre bir bütün olarak bölünmeye "karar vermekte" ve hücrenin içindeki farklı parçalar bu bölünme kararına uygun olarak davranmaya başlamaktadırlar. Hücrenin böylesine kollektif bir işi kendi aklı ve iradesiyle yapmadığı açıktır. Bölünme işlemi, gizli bir emir ile başlar ve başta DNA olmak üzere hücrenin tümü buna göre hareket eder.

DNA, kendini çoğaltmak için önce karşılıklı iki parçaya ayrılır. Bu olay oldukça ilginç bir şekilde gerçekleşir. Yapısı sarmal bir merdivene benzeyen DNA molekülü, bu merdivenin basamaklarının ortasından fermuar gibi ikiye ayrılır. Artık DNA iki yarım parçaya bölünmüştür. Her iki parçanın da eksik olan yarıları (eşlenikleri) ortamda hazır bulunan malzemelerle tamamlanır. Böylece iki yeni DNA molekülü üretilmiş olur. Operasyonun her kademesinde enzim denilen ve adeta gelişmiş robotlar gibi çalışan uzman proteinler görev yapar.  İlk bakışta basit gibi görünse de bu operasyon sırasında gerçekleşen ara işlemler o kadar çok ve karmaşıktır ki, olayı ayrıntılarıyla anlatmak sayfalar tutar.



DNA Sarmalının Eşlenmesi:Sarmal bir çok enzimin yardımıyla önce bir fermuar gibi ikiye ayrılır Daha sonra her parçanın eşleniği olan nükleotidler ortan-mdan temin edilerek yarım parçaya yapıştırılır. Böylece birbirinin kopyası iki yeni DNA sarmalı oluşur.

Eşleşme sırasında ortaya çıkan yeni DNA molekülleri denetleyici enzimler tarafından defalarca kontrol edilir. Yapılmış bir hata varsa—ki bu hatalar son derece hayati olabilir—derhal tesbit edilir ve düzeltilir. Hatalı şifre kopartılıp yerine doğrusu getirilir ve monte edilir. Bütün bu işlemler öyle baş döndürücü bir hızla yapılır ki, dakikada 3.000 basamak nükleotid üretilirken bir yandan da tüm bu basamaklar görevli enzimler tarafından defalarca kontrol edilir ve gereken düzeltmeler yapılır.

Üretilen yeni DNA molekülünde, dış etkiler sonucunda normale göre daha fazla hata yapılabilir. Bu sefer hücredeki ribozomlar, DNA'dan gelen emir doğrultusunda DNA onarım enzimleri üretmeye başlarlar. Böylece DNA kendi kendini korur ve hem kendisini hem soyun devamını güvence altına alır.

Hücreler de insanlar gibi doğar, çoğalır ve ölürler. Ancak hücrelerin ömrü meydana getirdikleri insanın ömründen çok daha kısadır. Örneğin altı ay önce bedenimizi oluşturan hücrelerin bugün büyük bir çoğunluğu hayatta değildir. Fakat zamanında bölünerek yerlerine yenilerini bıraktıkları için, siz şu anda hayatta kalabilmektesiniz. Bu yüzden hücrelerin çoğalması, DNA'nın kopyalanması gibi işlemler—her ne kadar çok karmaşık da olsalar—insanın varlığını sürdürmesi açısından en ufak bir hataya yer verilmemesi gereken hayati işlemlerdir. Ancak çoğaltma işlemi o kadar kusursuz işler ki, hata oranı 3 milyar basamakta yalnızca bir basamaktır. Bu tek hata da herhangi bir probleme sebep olmadan vücuttaki daha üst kontrol mekanizmaları tarafından yokedilir.

İşte bütün gün, siz hiç farkında değilken, vücudunuzda sizin yaşamınızın problemsiz olarak devam etmesi için akıl almaz bir titizlik ve sorumluluk anlayışı içinde sayısız işlemler ve denetimler yapılır, tedbirler alınır. Herkes görevini eksiksiz olarak ve başarıyla yerine getirir. İşte Allah en büyüğünden en küçüğüne, en basitinden en karmaşığına kadar sayısız atomu ve molekülü sizin yaşamınızı güzel ve sağlıklı bir biçimde sürdürmeniz için hizmetinize vermiştir. Yalnızca bu lütuf ve nimet bile hiç durmadan şükretmeniz için yeterli değil midir? Yoksa insan aklının başına gelmesi için mutlaka bu kusursuz sistemde bir takım sorunlar yaratılmasını mı beklemelidir?

İşin en ilginç yönü de, DNA'nın hem üretimini sağlayan hem de yapısını denetleyen bu enzimlerin, yine DNA'da kayıtlı olan bilgilere göre ve DNA'nın emir ve kontrolünde üretilmiş proteinler olmasıdır. Ortada içiçe geçmiş öyle muhteşem bir sistem vardır ki, böyle bir sistemin kademe kademe oluşan tesadüflerle bu hale gelmesi hiçbir şekilde mümkün değildir. Çünkü enzimin olması için DNA'nın olması, DNA'nın olması için de enzimin olması, her ikisinin olması içinse hücrenin, zarından diğer bütün kompleks organellerine kadar eksiksiz olarak var olması gerekir.

Canlıların birbirini izleyen "yararlı tesadüfler" sonucunda "aşama aşama" geliştiklerini öne süren evrim teorisi, sözkonusu DNA-enzim paradoksu tarafından kesin biçimde yalanlanmaktadır. Çünkü DNA'nın ve enzimin de aynı anda var olması gerekmektedir. Bu ise bilinçli bir müdahaleyi zorunlu kılar.

EVRİM MASALININ SON SIĞINAĞI: MUTASYONLAR

Darwin, teorisini ortaya atarken, ne aynı tür içindeki çeşitliliğin nedenini, ne de kendi uydurmalarından biri olan, 'bir türün başka bir türe değiştiği' iddiasının mantığını açıklayamamıştı. Açıklayamazdı da çünkü Darwin'in DNA'dan haberi yoktu. Darwin ne genetik, ne biyomatematik, ne de mikrobiyoloji biliyordu. Bu bilim dalları Darwin yaşadığında var olmadığından zaten bilmesine de imkan yoktu. Sahip olduğu imkanlar ile değişik hayvanları kesmiş, iskeletlerindeki benzerliklerden yola çıkarak bilimsel olmayan hayal mahsulü çıkarımlar yapmıştı. Yukardaki bilim dalları henüz olmadığından hücre hakkında bir çalışma yapmasına da imkan yoktu.

Bugün gelişen teknoloji ile insanlar hücrenin sahip olduğu kusursuz ve kompleks mekanizmalardan haberdar oldular. Bunların tesadüfen veya zamanla kendi kendilerine varolamayacakları da anlaşıldı. Zira, bu kompleks sistemin bütün parçaları aynı anda, aynı yerde eksiksiz ve fazlasız olarak ortaya çıkmış olmalıydı. Dahası, sözünü ettiğimiz bu sistem de binlerce farklı alt sistemlerden oluşmaktaydı. Bu durumda, aynı anda, aynı yerde, eksiksiz bir düzenin bir kerede var olmasının tek bir açıklaması vardı: "Yaratılış". Böylelikle insanları, yaratılışı inkar yoluyla Allah'ın yolundan çevirmek için ortaya atılan evrim teorisinin ne kadar büyük bir yalan olduğu, gelişen bilim ve teknoloji ile bir kez daha ispatlanmış oldu.

Ancak, evrim bilimsel bir gerçek değil dine karşı olan bütün ideolojilerin dayandıkları uydurma bir temeldi. Bu yüzden de ne pahasına olursa olsun bu yalan sürdürülmeliydi. Çare bir başka yalanda bulundu: "mutasyon".

Evrimciler, ilkel türlerin gelişmesinin ve farklı yeni türlerin meydana gelmesinin mutasyonlar sonucunda gerçekleştiğini öne sürdüler.

Mutasyon canlının DNA'sında dış etkilerle (kimyasal maddeler, X ışınları, radyasyon) meydana gelebilecek değişikliklerdir. Fakat bu değişiklikler hiçbir zaman yeni bir türün oluşumuna imkan vermez, çünkü mutasyonlar genetik bilgide meydana gelen eksilme veya yer değiştirmelerdir. Yoksa genetik bilgiye yeni birşeyler eklenmez. Her canlının genetik bilgisinde kendi türüne ait bilgiler kaydedilmiştir. Dolayısıyla genetik değişiklik (mutasyon), o canlı türünde var olan organ ve yapıların sayı, renk ve biçimi üzerinde kısıtlı değişiklikler yapar. Canlıya hiçbir şekilde yeni bir organ veya özellik kazandıramaz. Kaldı ki mutasyonların yüzde 99.9'u canlı için zararlı, hatta öldürücüdür. Geri kalan yüzde 0.01'lik kısım ise etkisiz ya da zararı ilk bakışta belirlenemeyen mutasyonlardır. Genetik ve fizyolojik yapıları kasıtlı biçimde mutasyona elverişli kılınmış virüsler dışında mutasyonun yararlı bir katkısı sözkonusu bile değildir.

DNA vücut hakkında içerdiği bilgi ve bu bilgiyi saklamasındaki tasarımla son derece gelişmiş bir yapıya sahiptir. Bu kadar gelişmiş bir sisteme yapılacak bir dış müdahale doğal olarak sistemi tahrip eder. Karmaşık mekanizmalı bir alete yapılacak rastgele bir değişim aleti daha gelişmiş bir yapıya getirmez, aksine bozar. Veya bir deprem bir şehri imar etmez, yıkar; tıpkı mutasyonun DNA üzerindeki etkisi gibi.

Farzedelim ortada faydalı bir mutasyon olsun. Her faydalı mutasyona karşı binlerce zararlı mutasyon olacak, genel etki türlerin ölmesine veya dejenere olmasına yol açacaktı. Bugün dünya ufak tefek mutasyonlara uğramış binlerce çeşit hilkat garibesi ile dolu olmalıydı. İnsanların kimi üç gözlü, kimi iki burunlu olarak yaşayacak, kediniz beş bacaklı yavrular doğuracaktı. Ama mutasyonlar zararlı oldukları gibi aynı zamanda son derece nadirdirler bu yüzden hayatta hiçbir yerleri yoktur.


Bir başka nokta da mutasyonların bir sonraki nesle aktarılması için yalnızca üreme hücrelerinde meydana gelmesi gerektiğidir. Vücudun herhangi bir hücresinde veya organında meydana gelen değişim bir sonraki nesle aktarılmaz. Örneğin bir kadın parmağını kaybedecek olsa, bebeği eksik bir parmakla doğmayacaktır.

Bin nesil boyunca her doğan maymuna iki ayak üzerinde yürümek öğretilse binbirinci nesil doğduğunda bu özellik yeni nesle geçmiş olmayacaktır.

Görüldüğü gibi mutasyonlar hiçbir şekilde canlılardaki çeşitliliğin nedeni olamazlar. DNA'daki kusursuz dizilim ancak özel bir yaratılışı gerektirir.